Home / Bilim Teknoloji / Yaşam, 3 Harfli Sözcüklerden İbarettir!

Yaşam, 3 Harfli Sözcüklerden İbarettir!

 Yaşamın Dilini Okumak ve Anlamak…

Matematiğin dili bizlere birçok insanın baktığı ama göremediği, Evren’in güzelliklerini ortaya seren bir araç sunmaktadır. Ancak antik filozofların ve matematikçilerin o dönemlerde asla anlayamayacağı ve bilmediği, ancak bizlerin bugün net olarak bildiğimiz ve anlayabildiğimiz, bir diğer dil daha var: yaşamın dili. Bu dilin de çoğu zaman farkına varmıyoruz, ancak emin olun, bu dil de matematik kadar baş döndürücü. Bu dilin adı, DNA.

DNA, ya da DeoksiriboNükleik Asit, bir biyopolimerdir ve fosfat-deoksiriboz omurgası üzerine inşa edilmiş, türden türe değişmekle birlikte insan için yaklaşık 3 milyar civarında nükleotit çiftini barındıran bir yapıdır. Nükleotitler, yaşamın alfabesini oluştururlar: Adenin,Timin, Guanin ve Sitozin (resmi olarak Cytosine olduğu için “C” harfi kullanılır). Bu 4 nükleotit, fosfat ve şeker molekülleriyle bir araya gelerek nükleobaz adını verdiğimiz yapıları oluşturur. İşte bu nükleobazlar, barındırdıkları nükleotitlerin baş harfiyle, A, T, G ve C olarak isimlendirilirler.
İşte bu 4 harf, Türkçede kullandığımız 29 harf veya İngilizcenin 26 harfi gibi, “yaşamın dili” dediğimiz dilin harfleridir. Alfabe illa birçok harften oluşmak zorunda değildir. Nasıl ki 29 harfle tonlarca kitap yazabiliyorsak, 4 harfle de şimdiye kadar var olmuş istisnasız her canlının,istisnasız her geni ve özelliği yazılabilmiş ve kodlanabilmiştir. Şaşırtıcı değil mi? Hem öyle, hem de değil aslında… Çünkü bu dil, bizim dillerimize göre son derece ilkeldir. Ancak yine de, milyarlarca türün evrim sürecinde özelliklerinin kodlanabilmesi için yeterli olmuştur. Gelin sizle bu harflerle yazabileceğimiz bir cümleye bakalım:
 ATGAAGTCGATCCTAGATGGCCTTGGAGACACCACCTTCCGTACCATCACCACAGACCTC…
Okuduğunuz kitaplardaki veya bu satırlardaki cümlelere pek benzemiyor değil mi? Ancak unutmayın! Bu yeni ve ayrı bir dil, dolayısıyla eğer okumak istiyorsanız, önce nasıl okunacağını öğrenmelisiniz. Ancak okumayı öğrenmeden önce, yazmayı öğrenmeyi deneyebiliriz.
Bu cümle, elbette ki hücrelerimiz içerisinde kalem defter kullanılarak yazılmıyor. Evrimsel süreçte oluşan DNA’nın torunları, her seferinde bir miktar farklılaşarak, yüz binlerce nesil boyunca bu yapıyı “kopyalanma” dediğimiz bir mekanizma ile torunlarına aktarmayı başarabilmiş, başaramayanlar da elenmiştir. Canlıların her bir özelliğini belirleyen yapılar, genel olarak proteinlerdir. Ve proteinler, yaşamın diline göre oluştururlar. Tıpkı “100 şınav çek asker!” şeklinde gelen, Türkçe bir emir üzerine, askerin emri olduğu gibi uygulamasına benziyor bu… Ancak asker de bu emri uygularken hata yapabildiği gibi, genlerimiz de kopyalanma sırasında hatalar yapabiliyor ve bu, genetik çeşitliliğin ana kaynaklarından biri oluyor. Hatalar olmasaydı, canlılık bugün bu kadar karmaşık olmayacaktı. Tıpkı hayatta hatalar yapmasaydık, bu kadar başarılı ve donanımlı olamayacağımız gibi…
Dolayısıyla, bu cümlenin yazılabilmesi ve dolayısıyla belli bir işin yapılabilmesi ya da belli bir özelliğin oluşabilmesi için, öncelikle bir emir gelmelidir. İşte bu emir cümlesi, DNA’nın kendisindeki 3 milyar baz çiftinin bir kısmından okunur. Eğer ki yukarıdaki, “hücre bölünmesini başlatmayı sağlayan proteinlerin” koduysa, o zaman “Hücre bölünmesini başlat!” emri, DNA’dan okunabilmelidir. İşte o emir, DNA’da şu şekilde kodlanır:
TACTTCAGCTAGGATCTACCGGAACGTCTGTGGTGGAAGGCATGGTAGTGGTGTCTGGAG…
Burada, her bir nükleotitin karşısına, onun “eşi” gelmektedir. Bu eş, bir A için (hata olmadığı sürece) her zaman T; bir G için (hata olmadığı sürece) her zaman C’dir. Adım adım takip edecek olursanız, tüm sıralamanın doğru olduğunu göreceksiniz. Dolayısıyla DNA, az önce verdiğimiz cümle sayesinde “Hücre bölünmesini başlat!” emri verir ve RNA aracılığıyla (emri uşağa ileten bir aracı, ulak gibidir) bu emir ribozoma taşınır ve ribozomda, mümkün olduğunca hatasız bir şekilde emrin sonucunu sağlayacak proteinler üretilir. Dolayısıyla aslında mekanizma son derece basit, son derece sıradandır. Ancak moleküler düzeyde bu organizasyonu görmek, birçokları için abartılacak bir unsur haline gelmektedir. Ne var ki biyokimyanın içerisine girip, moleküllerin birbiriyle olan etkileşimleri incelendiğinde ve bu etkileşimlerin ne kadar spesifik ve ne kadar spontane olduğu anlaşıldığında, aslında zaten moleküllerin, uygun oldukları tepkimelere girmekten başka pek de çareleri olmadıkları görülecektir. Dolayısıyla her şey, moleküllerin sayıca ve türce fazla olmasında bitmektedir. Bu fazlalık sağlandığında (ki evrenimizdeki moleküler ve atomik çeşitlilik bunu mümkün kılmaktadır), bir “şehir gibi” karmaşık ağların hücre içerisinde görülmesi o kadar da şaşırtıcı olmaktan çıkmaktadır. Elbette heyecan verici ve etkileyici, ancak “inanılmaz” değil.
Şimdi… Emir-komuta zincirini anladık sanıyoruz ki: emir DNA’dan gelir, aracılardan geçer ve bir protein, yani bir iş/ürün/sonuç olarak ortaya çıkar. Öyleyse, şimdi bu dili nasıl okuduğumuza veya hücrelerimizde nasıl okunduğuna geçelim:
Nasıl ki, her cümleyi harflere ve sözcüklere bölerek analiz edebiliyorsak, yaşamın dili de harflere ve sözcüklere bölünebilir. Harflere bölündüğünde ne elde ettiğimizi artık biliyoruz: A, T, C ve G. Ancak sözcüklere bölme işi, dilin aslında ne kadar ilkel olduğunu ve niye böyle nitelediğimizi anlamanızı sağlayacaktır: yaşamın dili, her zaman 3 harflidir. Yani, yaşamın dilindeki sözcüklere bakacak olursanız, asla 1-2 harfli ya da 3’ten fazla harfli bir sözcük bulamazsınız. Bu dildeki sözcükler, her zaman 3 harflidir. Yani nasıl ki “Hücre bölünmesini başlat!” emrini, Türkçe olarak analiz ettiğimizde 5, 6 ve hatta 11 harfli sözcükleri görebiliyorsak, yukarıda verdiğimiz genetik emir cümlesini ya da proteini (emrin sonucunu) okuyacak olursak, sadece 3 harfli sözcükler kurabiliriz. Şöyle:
ATG AAG TCG ATC CTA GAT GGC CTT GCA GAC ACC ACC TTC CGT ACC ATC ACC ACA GAC CTC…
Daha anlaşılır, değil mi? Eh, “Hücrebölünmesinibaşlat!” yazmaktansa, “Hücre bölünmesini başlat!” yazmakta olduğu gibi… Ancak biz 29 harf ve neredeyse sınırsız sözcük uzunluğumuzla on binlerce kelime türetebiliriz. Ne var ki yaşam, bu 4 harfle ve sadece 3 harf uzunluğundaki sözcüklerle sadece 64 tane sözcük üretebilir. Ancak unutmayın! Bu başka bir dil! Türkçe ya da diğer insan dillerinde sözcüklerin nasıl yan yana geldikleri önemlidir ve her dizilim, anlamlı cümleler oluşturmaz. Örneğin: “Hücre koşuşturmasını uçur!” cümlesinin hiçbir anlamı yokken, “Hücre bölünmesini başlat!” anlamlı bir cümledir. Ne var ki yaşamın dilinde tam olarak böyle değildir: bu 64 sözcük, sınırsız sırada ve sınırsız uzunlukta bir araya gelerek, her seferinde anlamlı, en azından bir ürün verebilecek ifadeler oluşturabilirler. İşte dilin bu özelliği sebebiyle yaşam bu kadar çeşitli olabilmektedir. Unutmayınız ki burada Türkçe analojisi kullanıyor olsak da, bahsettiğimiz diller yapıca ve nitelikçe birbirinden son derece farklı olgulardır. Tabii iki konu arasındaki benzerlikler de aşikar… Bir diğer örnek:
Bu dilin içerisinde, “cümle başlangıcı” (aynı “büyük harf” gibi) ve “cümle sonu” (nokta gibi) sözcükler vardır. Örneğin GTC sözcüğü, “Buradan okunmaya başlayacak.” anlamına gelebilirken, AUG sözcüğü “Burada okumayı sonlandır.” anlamına gelmektedir. Bunu ilkel bir kabilenin tek ses ile çok şey anlatmasına benzetebilirsiniz. Tabii yaşamın dilinde “ses” ile işimiz yok…
İşte bu şekilde, basit bir başlangıçtan, bu kadar güzel ve karmaşık bir yaşam ortaya çıkabilmektedir. Adeta olay yerine sonradan ulaşan detektifler gibi, genleri analiz ettiğimizde, yaşamın evrimsel süreçte nasıl değişerek, nasıl kademeli olarak günümüze ulaştığını anlamamız son derece kolay olmaktadır. Örneğin, gelin bir güve, bir meyve sineği ve bir deniz kabuklusu gibi apayrı canlıların, genetik dizilimlerinin aynı bölgesinden alınan cümlelere bir bakalım:
 Güve:
GTC GGG CGC GGT CAG TAC TTG GAT GGG TGA CCA CCT GGG AAC ACC GCG TGC CGT TGG…
Meyve Sineği:
GTC GGG CGC GGT TAG TAC TTA GAT GGG GGA CCG CTT GGG AAC ACC GCG TGT TGT TGG…
Deniz Kabuklusu:
GTC GGG CCC GGT CAG TAC TTG GAT GGG TGA CCG CCT GGG AAC ACC GGG TGC TGT TGG…
Durmayın, kontrol edin. Arada 1-2 farklılık göreceksiniz. Bu tıpkı, bir kitabın fotokopi ile değil de, el yazması olarak binlerce, milyonlarca defa, olabildiğince özenli ama insani hata sınırlarıyla birlikte kopyalanması sonucunda, birkaç yüz harfte 1-2 defa yapılan hatalara benzemektedir. Ancak bu ufak hatalar, bir araya gelerek ve birikerek, daha da önemlisi bu değişimlerden kaynaklı özellik farklılıklar, içinde bulunulan doğa koşullarına göre seçilerek, günümüze kadar ulaşabilmekte ve türün ayırt edici özelliklerinin oluşmasında ve yeni türlerin evrimleşmesinde görev almaktadırlar. Halbuki yukarıdaki üç canlıya dışarıdan bakacak olursanız, tamamen farklı olduklarını göreceksiniz. Farklı görünürler, farklı yaşarlar, farklı davranırlar, farklı eşsiz nitelikleri vardır… Ancak özlerinde, genetik kodlarına baktığımızda, evrimsel sürecin imzasını parlak bir şekilde görürüz. Esasında Dünya tarihinde ve bugününde ele alacağınız her iki tür, her iki birey, evrimsel süreçte birbiriyle mutlaka akrabadır. Ancak bu akrabalık 1. derece kadar yakın olabileceği gibi, yüz bininci derece kadar uzak da olabilir. Baş döndürücü olansa, tıpkı kopyalanan bir kitaptaki hataları takip ederek tarih içerisindeki farklı kopyalara ulaşabilmemiz gibi, türlerin genlerindeki hataları takip ederek, ortak atalara ve akrabalık ilişkilerine ulaşabiliyor olmamızdır.
Bu yazıda sizlere yaşamın diliyle ilgili bazı temel bilgileri verdik ve bazı analojiler kurarak anlamanızı kolaylaştırmaya çalıştık. Umuyoruz ki faydalı olmuştur.

Rastgele Haber

Dünya Benzeri 7 Yeni Gezegen

Nasa, Dünya benzeri 7 yeni Gezegenin keşfedildiğini açıkladı. NASA, Spitzer Uzay Teleskobu ile yapılan çalışmalar …

Bir Cevap Yazın

E-posta hesabınız yayımlanmayacak. Gerekli alanlar * ile işaretlenmişlerdir